AlliumTDB
Sequence
>CL7069.Contig2_A.roylei_Root    size  1319    gap  0  0%
GATTTATCGTACAACCGAAATGTCCATTTTTACGTTTTTTATGATCGCTC
AACTTCTAGGTACTAATAGCAAAAATTTCCCAACAAACAGAAAAATCAGG
ATATGATAATTGGCCCTACGATTTCTCCTCATATCCACGTCGAAAGCAAG
TGAGAGCATAGCTTGCGCTCAAAAATTCTCCCAAATACGTACATAACTAC
AAACAAACAAATTAAAGTTAGAATCGAAGGATGCAGATCGAAGAATTGAA
AGATCAGGACCCACCGGAAATAGTGTATGAGGAAAAGATATTGGTTGATG
AAAATGAAAAATCAGGGATAGGGTTGATTGATGCAAAAAAAGTTGCGGTT
GGGGTTGGGGCTAGGGTTTTATTTTATCCGACGTTGATTTATAATGTTGT
TAGGAACAAGATTCAAGCCGAGTTTAGATGGTGGGATCTGGTTGATGAGT
ACTTGTTGCTTGGTGCAGTTCCATTTCCTAGTGATGTTCCATACTTGAAA
GAACTTGGTGTTTGCGGAGTAATTACTTTAAATCAGCCATATGAGACTTT
AGTGCCTTCATCTTTGTACCATGCCGTCGGAATTGAACATTTGGTATTGC
CGACTGTAGATTACTGCTATGCACCACGACTAGAAGATATATGTAAAGCA
GTGGCCTTCATTCATGAGAATGCTTCTGCTAAGAAATCAACGTATGTTCA
CTGTAAAGCTGGTCGAGGGAGAAGCACAACCATCGTTCTATGTTATCTGG
TTCGACATAAACAGATGACGCCCATTCAAGCATATGAGCATGTGAAACAA
ATAAGGCCACGAGTTCTTTTAGCCCCTCTTCAACGGAAGGCCGTGGAGTA
CTATTATCATCTTTTGGTGAAGAAAACCGTGTTGCCAAGTAGTTATGTTT
ATCCAATCATGAAACAGCCAGCAACCATAGTGACATTGAATGGGAATGTC
ATGAAATTTGATGAAAGCTCATTTGTTGTAGTTTCGAAATCCGATCTTGA
TGGTTACACTCCCAACGGTTGCAAAGCAACTACTAACAGCAGCAGCAGCA
TATGGGAGCTAAGTCTTGTATATCGTGTTCAGTTTGCTGGACAAGCAGCT
CTTGCCAGTCTCTCTTGCTTATGGCTTGGATATCGGACATCAAATAACAA
TGGTGTCATTGGCAATAACGAGACATGTAATAAGGTGGCGAGGGAGAGCT
CTTGCTCTTTGGAGGCTGATAAGGTTGGAATGGGGCATTCTTGCATCGTC
AGTGGAGTTGTCATAAATTTGTAAATATTAATAATAACTCGTGGACACCA
CCTTCCTCTTAAATCACAG