AlliumTDB
Sequence
>CL3.Contig1_DHA_Bulb    size  314    gap  0  0%
CGCCGTATTTATCCCTTCTTTTATAAGGTCTGCCAATTTCTTTTGTTTGC
TCCGAATCGTGCATCTCTTCAGATACTTCAACTTCATGTTTCATGCTGCG
CTCTTTCTTTTCCTTTTCTTTTGCATACACTTTCTCCTTTTCTCTTTCCT
TCACTTTTTCCTTGCTATCCTTGTGCAAACTACTGCTACTTCCTCTTCTG
CTTCTTTGCTTATCCATCCTCTTCTCCTCATTCTTTTCATTCATATCACC
ACATTTTTTACTGGAACTACTATTAAACTTTCCTTTTGCTTCTTTATCAA
CTTTTGGATCCTCG