AlliumTDB
Sequence
>CL11.Contig5_DHA_Bulb    size  2256    gap  0  0%
TATTAATACCCTCCACTTCCCATTCTCTCACTTGCCTTTCTTCCCCCTTT
TCCACCATGGATGCTTACGAAGCAACACGCATAGTCTTCTCCAGAATCCA
AACCCTAGACCCCGAAAACGCTGCAAAAATCATGGGTCTTCTCCTCATCC
AAGACCACAGCGAAAAGGAAATGATCCGTTTAGCTTTCGGACCTGAAGCC
CTTCTGCATTCCCTCATCCTAAAAGCCCGAAAAGATCTCAACTTGCTGCC
TCCTTCTCCTTCCTCCGCCTCCTCAAATCCTTTTCAAAGACAAAATCGTG
CTCCACCACCTCCCCTTTCCATAAACTCACCTTCCTGGGCCCCACCCCAA
CCCGACCTGTTTAGCCCCGAAGATGAATTTCTCAACGAGCAGATGTACGA
CGGAAGCAGCACGCACCACCGTAGAAGCTACTCGGATTTCGACGCTGCGG
GTTTCGGTTGGAAGCCGTGCCTATACTACGCGCGTGGATTTTGCAAGAAC
GGAAGCGCGTGCAGGTTTCTGCATGGAATGCCCGAAGATGGATCCGGTAT
GAGCAACATCGAGCAGGAGTTGATGCTCATGAGATCTAAAAGCCAGCGCC
TTGGTTCCGCTGCCAGCATGTGTTTTCCTTACTCGCCTACCGGTTCTCTT
GGCCCCATGTCGCCTTCTTCTTCTTCCTTTTTGTTTCAGCAGGAGAAGCA
GAGAGCTTCGACTGCAGCAGCAGCTGCTGCTATGATGCTAGGTGGTGATG
ACGGTTATAAATTTATGAGTCCGAGAACGGATCCAGGTGCTAGACAGATT
TACTTGACCTTTCCAGCTGATAGCACTTTTAGAGAGGAAGACGTTTCCAA
TTATTTCAGTATATACGGACCTGTTCAAGATGTGAGAATTCCATATCAAC
AGAAGAGGATGTTTGGGTTTGTGACATTTTTGTATCCAGAGACCGTTAAG
CTGATTTTAGCAAAAGGAAATCCTCATTTTGTTTGTGATGCTAGAGTTCT
TGTTAAGCCTTACAAGGAGAAAGGCAAAATTGCAGAGAAAAAACTGCAAG
CAGAAAGAGGAGATTTCTCTGGTGGTAATACTCCTACTGGATTTGATACA
AGAGATCCATTTGATTTTCAACAACTTGGACCAAGATTGATGTATGGTAA
TAGCAATCAAGAAATGATGCTGAGGAGGAAGCTAGAGGAGCAGATGCAAG
CAGCTGAGCTTCAGCAGGCAATTGAAATGCAAGGAAGGAGATTTATGGGG
CTTCAGCTTCTCGATTTCAAGAACAGAAGCATGTCAACTTCTACTACCAT
TTCAAGCAGAACTAATGATATTAGTCATGATGGTTCTCCAACTGAAGAAA
AAAGTCCGAGTCCTGTAATGTTGTCTGCAGTCAACGCTGCTGCAGTAGGT
GCTGATAAAGATGAAACTGCTGAAACAGGAAGAGAGGTTACCACCAAATC
CAATGAAGATAGTGATTTCCAAGAAAGAACTGAGCACAATTTGCCCGATA
GCCCGTTTGCATCTCCTACCAAAGCTTCTTCCTTCGTCAATGGTCCATTT
TCTGTACAGTCTGCCTCTGTGCTTGATTCAGAGTTTTTAAATGGAAATGG
AAGCCATATTATTGATTCTTCACCATCTTCTGCTCTGGATATGGCTTCTT
TTAAATCATGCTTTTTTCAAATGCCAAGGTTCTCATCTGGTCATGGAGCT
GTTGGCCTGTGACAGTATGAAATGACTGCTCTCTCCCCAAAATTCAAAGA
AAAAAAAAAGTTTGAAGTAAAGTTAAAAAAGTAGGATGAAAGAAGAGGAA
TACATGAAGAAATAGAGGTCTTTTTAGGTTTTATAGTGTCTAATGTGTTT
AGCTATAAAGAATCAAAGATGGTGTGCACATCATCGCTTTTTTTTTTCTT
TTTCCTAGGAGGTAATTGAAGTGAATATTACAGGACAATATAAGCGTTTT
TACTAGTGTTGTTACTTATGTAAGCTACAAAGAAAGCAACTAGCTAGCAT
GACTGAGCCCCAACCACCAAATAGGACAATAGCATATGAATTATGAAGTA
GAAAAGGAAAGCAAAGGCAGAAAAAGTTGAAAGAAGAAGACAGTGTAAAA
TCCCATCTGATCTGTCTGAAAAGGAGAGCTGAGCTATATGAATTATAAAG
ATAGGACCATTCAGCACAAGAAGATAAGAAGAGCTATTACTATTATGATA
TGATGCTGATTATGATATGATGATGAATGTATCAAATATGATATGATATA
ATATTT